Abstract: To investigate the effects of structure and inserted/deletion（InDel） variant of PLIN1 gene on tail fat and growth traits of Tong sheep, bioinformatics of the structure of PLIN1 gene was analyzed, and tail fat and growth traits from 166 healthy Tong sheep were measured. The InDels loci and typing of PLIN1 gene were detected by Tong sheep phenotypic data measurement, genomic DNA extraction, PCR, agarose gel electrophoresis and Sanger sequencing, and then the polymorphisms of PLIN1 gene were analyzed by correlating them with the tail fat and body size traits of Tong sheep. The results showed that the PLIN1 gene was located on chromosome 18 of sheep, consisting of 8 exons and 7 introns. The protein structure of PLIN1 across Ovis aries, Capra hircus, Bos taurus, Sus scrofa, Homo sapiens, and Mus musculus was highly conserved. The PLIN1 protein structure of Gallus gallus and Anas platyrhynchos was different from that of other species. Across these eight species, PLIN1 protein of the above 8 species exhibits 10 conserved motifs and 2 specific conservative domains, indicating that PLIN1 gene was relatively conserved in species evolution. The PLIN1 gene in Tong sheep had an InDel site of 26 bp（CGATCCTCGGTGCCCCAGAAACATTC）, including DD, II, and ID genotypes. The allele frequencies of the I and D were 0.201 8 and 0.798 2,respectively, and the frequencies of the II, ID, and DD genotypes were 0.066 3, 0.271 1, and 0.662 7, respectively. This locus was in the intermediate polymorphism（0.25＜PIC＜0.5） and Hardy-Weinberg equilibrium.The InDel locus of PLIN1 gene had no significant effect on the traits of tail length and tail width in Tong sheep（P＞0.05）; the locus had no significant effect on the growth traits of rams（P＞0.05）; however, the dorsal height of ewes of II genotype at this locus was significantly higher than that of ID and DD genotypes（P＜0.05）. The results indicated that the Indel locus of PLIN1 gene could be used as a useful molecular marker for ewe breeding.